Journals of Gerontology Series A: Biological Sciences and Medical Sciences Large Type Edition
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kyoung Kim, H.
Right arrow Articles by Kim, J.-R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kyoung Kim, H.
Right arrow Articles by Kim, J.-R.
The Journals of Gerontology Series A: Biological Sciences and Medical Sciences 60:4-9 (2005)
© 2005 The Gerontological Society of America

Down-Regulation of a Forkhead Transcription Factor, FOXO3a, Accelerates Cellular Senescence in Human Dermal Fibroblasts

Hyun Kyoung Kim1, Yu Kyoung Kim1, In-Hwan Song2, Suk-Hwan Baek1, Seung-Rock Lee3, Jung Hye Kim1 and Jae-Ryong Kim1,

1 Department of Biochemistry and Molecular Biology
2 Department of Anatomy, College of Medicine, Yeungnam University, Daegu, Republic of Korea.
3 Department of Biochemistry, Chonbuk National University Medical School, Chonju, Republic of Korea.

Address correspondence to Jae-Ryong Kim, Department of Biochemistry and Molecular Biology, College of Medicine, Yeungnam University, 317-1 Daemyung-Dong, Daegu 705-717, Republic of Korea. E-mail:kimjr{at}med.yu.ac.kr


    Abstract
 Top
 Abstract
 Methods
 Results
 Discussion
 References
 
The signaling pathway of insulin/insulin-like growth factor/phosphatidylinositol-3 kinase/Akt/forkhead transcription factors is known to control life span and senescence in organisms ranging from yeast to mice. The FOXO family of forkhead transcription factors, FOXO1, FOXO3a, and FOXO4, play a critical role in this signal transduction pathway. However, the impact of FOXO3a activation on life span of primary cultured human dermal fibroblasts (HDFs) is unknown. To investigate the role of FOXO3a in the regulation of cellular senescence, we prepared FOXO3a-siRNA stable HDFs. We found that the down-regulation of FOXO3a RNA and protein in HDFs induced many senescent phenotypes, including changes in cell morphology, increases in population doubling times, senescence-associated ß-galactosidase staining and the cellular reactive oxygen species, and up-regulation of p53/p21 protein expression. Our data provide evidence of the key role of FOXO3a transcription factor as a mediator of cellular senescence in HDFs, and suggest that the mechanism of senescence is conserved in HDFs.


PRIMARY human cells have a limited ability to divide when cultured in vitro, and eventually enter a state of irreversible proliferative arrest, termed replicative senescence (1), which is accompanied by specific changes in cell morphology (2,3), gene expression, and function (4). A number of molecular theories have been suggested to explain cellular senescence and human aging, e.g., free radical/mitochondrial DNA (5–8), developmental, and genetic (9,10). Genetic analyses have demonstrated that the signal transduction pathway of insulin/insulin-like growth factor-1 (IGF-1)/phosphatidylinositol-3 kinase (PI3K)/Akt (PKB) is involved in the aging of many organisms, such as nematodes, fruit flies, and mammals (11). In addition, the forkhead transcription factors, like DAF-16 in Caenorhabditis elegans, and its mammalian homologues, FOXO1 (FKHR), FOXO3a (FKHR-L1), and FOXO4 (AFX), play an essential role in this signal transduction pathway (12).

Studies in mammalian cells have shown that the FOXO family of forkhead transcription factors, FOXO1, FOXO3a, and FOXO4 play important roles in diverse biological processes, which include cellular transformation, differentiation, metabolism, proliferation, and aging depending on physiological conditions and cell types (13–21). The activation of DAF-16 in C. elegans by reducing function mutation in the PI3K/Akt pathway resulted in a life-span extension by modulating oxidative stress response (22). Some genetic alterations like the homozygous deletion of p66shc (23,24), IGF-1 receptor (25), or insulin receptor (26), which are mediated via the PI3K/FOXO signaling pathway, demonstrated to increase life span in mammals. However, FOXO3a knockout mice showed no differences in longevity (27), and the disruption of each of the Foxo genes demonstrated that the physiological roles of Foxo genes are functionally diverse in mammals (28). Recently, Miyauchi and colleagues (29) reported that the in vitro life span of human endothelial cells is regulated negatively by Akt via a FOXO3a and a p53/p21 pathway, suggesting that the mechanism of senescence is conserved in primary cultured human cells. Although these studies have suggested that FOXOs have important roles in diverse biological processes, the impact of FOXO3a activation on the growth and life span of primary cultured human dermal fibroblasts (HDFs) is unknown. In the present study, we prepared FOXO3a-siRNA stable HDFs to investigate the role of FOXO3a in regulating the senescence of primary human cells. We found that the down-regulation of FOXO3a expression can accelerate cellular senescence of HDFs, suggesting that the mechanism of senescence is conserved in HDFs.


    METHODS
 Top
 Abstract
 Methods
 Results
 Discussion
 References
 
Dulbecco's modified Eagle's medium (DMEM), diapase, and a penicillin-streptomycin-fungizone antibiotic solution were obtained from Life Technologies (Gaithersburg, MD). The oligonucleotides for polymerase chain reaction (PCR) primers of FOXO1a (FOXO1a-1589F, gacgccgtgctactcgtt; FOXO1a-2047R, cggttcatacccgaggtg), FOXO3a (FOXO3a-1545F, agaactccatccggcaca; FOXO3a-2039R, tatcagtcagccgtggca), FOXO4 (FOXO4-1936F, ccctctcaggagccatca; FOXO4-2466R, acctggtccgtaggggag), and for FOXO3a-siRNA (forward, cggaattccaaggataagggcgacagcaattcgttgctgtc; reverse, cgctctagagcaaaaaaaggataagggcgacagcaacgaattg) were obtained from Bioneer Inc. (Daejeon, Korea). A rabbit polyclonal antibody against glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was donated by Dr. K. S. Kwon (KRIBB, Daejeon, Korea), a tumor protein D52-like 1 (TPD52L1) antibody by Dr. S. Cho (Research Center for Systemic Proteomics, KRIBB), and an erythrocyte membrane protein band 4.1-like 3 (EPB41L3/Dal-1) antibody by Dr. I. Newsham (Hermelin Brain Tumor Center and Department of Neurosurgery, Henry Ford Hospital, Detroit, MI). Antibodies against FOXO3a, phospho-FOXO3a (pFOXO3a), ERK, and phospho-ERK (pERK) were obtained from Cell Signaling Technology (Beverly, MA), and antibodies against p53 and p21 from Santa Cruz Biotechnology (Santa Cruz, CA). The pSKII vector was purchased from VectorCore A (Daejeon, Korea).

Cell Culture and the Induction of Senescence
Primary HDFs were obtained from the foreskins of 10-year-old boys; written consent was obtained from the parents of all participants. The foreskins were aseptically collected and washed several times with phosphate-buffered saline containing 1% antibiotic-antimycotic solution. After removing the hypodermis, foreskins were treated with 2.5% diapase in DMEM at 40°C overnight, and the epidermal cell sheet was then peeled off with a pair of tweezers. The pure dermis was cut into small pieces and cultivated in DMEM containing 10% fetal bovine serum (FBS) and 1% antibiotic-antimycotic solution at 37°C in 5% CO2 humidified air. After 5–6 days, the fibroblasts were harvested, propagated by trypsinization, and replated at 1 x 105 cells in 100 mm culture plates. When subcultures reached 80%–90% confluence, serial passaging was done by trypsinization, and the number of population doublings was monitored for further experiments. For the experiments, cells were used in either passage 8 (population doublings < 24) or passage 28 (population doublings > 55). These are referred to as "young" and "old" cells, respectively.

Generation of FOXO3a-siRNA Stable Fibroblasts
The FOXO3a (aaggataagggcgacagcaa) siRNA sequence (30) was inserted into the pSKII (U6+27) plasmid according to the manufacturer's instruction. Cells in passage 6 (population doublings < 18) were seeded at 1.5 x 105 cells/cm2 in six-well tissue culture dishes containing DMEM supplemented with 10% FBS. Recombinant plasmid DNA (1 µg/plate) and pHYK DNA (50 ng/plate) were introduced into the cells using LipofectAMINE 2000 (Life Technologies). After a 3- to 5-hour incubation, DMEM supplemented with 10% FBS was added. To achieve stable transfection, cells were incubated in medium containing 700 µg/ml G-418 for 2 weeks; positive clones were then selected.

Total RNA Preparation and Reverse Transcription-Polymerase Chain Reaction (RT-PCR)
Total RNA was extracted from young and old fibroblasts by using Tri reagent (Molecular Research Center, Cincinnati, OH). Semi-quantitative RT-PCR was used to validate the expressions of FOXO1a, FOXO3a, and FOXO4 genes in FOXO3a-siRNA stable fibroblasts (31).

Senescence-Associated ß-Galactosidase Staining
The proportion of HDFs positive for senescence-associated ß-galactosidase (ß-gal) activity was determined as described by Dimri and colleagues (2). Cells were plated at 1 x 104 in 35 mm culture dishes and fixed with 3% formaldehyde for 5 minutes. The presence of senescence-associated ß-gal activity was determined by incubating cells with 1 mg/ml of 5-bromo-4-chloro-3-indolyl ß-D-galactopyranoside in 40 mM citric acid/phosphate (pH 6.0), 5 mM K3FeCN6, 5 mM K4FeCN6, 150 mM NaCl, and 2 mM MgCl2. Blue staining was visible after incubating for 12 hours at 37°C, and the percentage of blue cells observed per 100 cells under a light microscope was calculated. Results are expressed as the means ± standard deviation of three independent experiments. After senescence-associated ß-gal staining, cells were counterstained with Mayer's hematoxylin.

Protein Extraction and Western Blot Analysis
Cells were lysed on ice using RIPA lysis buffer (25 mM Tris, pH 7.4, 150 mM KCl, 5 mM EDTA, 1% Nonidet P40, 0.5% sodium deoxycholate, and 0.1% sodium dodecyl sulfate (SDS), 1 mM Na3VO4, 5 mM NaF, and 1 mM phenylmethylsulfonyl fluoride). Cell disruption was completed by vortexing for 30 seconds on ice. Following centrifugation at 15,000 rpm for 10 minutes at 4°C, protein concentrations in the supernatants were quantified by the bicinchoninic acid method (Pierce Biotechnology, Rockford, IL) using bovine serum albumin as a standard. Thirty-microgram samples of protein were separated on 10% SDS polyacrylamide gels, and then transferred to nitrocellulose membranes. The membranes were treated with primary antibodies against FOXO3a, pFOXO3a, Akt, pAkt, ERK, pERK, and GAPDH. Secondary antibodies conjugated to horseradish peroxidase were detected by chemiluminescence (KPL, Gaithersburg, MD).

Detection of Intracellular Reactive Oxygen Species (ROS) Levels
HDFs were incubated with 10 µM dihydrorhodamine123 (DHR123) for 30 minutes. DHR123 is oxidized intracellularly to form the fluorescent compound rhodamine123 (RH123) by ROS, and is then pumped into mitochondria. After incubation with DHR123, cells were trypsinized and harvested. RH123 fluorescence intensities of 10,000 cells were measured for each sample using a FACSCaliber flow cytometer (BD Immunocytometry Systems, San Jose, CA).

N-Acetylcysteine Treatment
HDFs were plated at 1 x 103 cells on 35 mm culture dishes and incubated overnight at 37°C in 5% CO2 humidified air. Cells were treated with 0, 5, and 10 mM N-acetylcysteine for 2 or 3 days. Cell morphology and the proportion of cells positive for senescence-associated ß-gal activity were examined.


    RESULTS
 Top
 Abstract
 Methods
 Results
 Discussion
 References
 
Differential Expression of FOXO3a in Young and Old Fibroblasts
To investigate whether FOXO3a is associated with the cellular senescence of primary cultured HDFs, we measured the levels of FOXO3a and pFOXO3a protein in young and old fibroblasts. Senescent cells had lower FOXO3a (an active form) levels and higher pFOXO3a (an inactive form) levels than young cells (Figure 1). Because the phosphorylation of FOXO3a is regulated by Akt activity, pAkt levels were measured by Western blotting. As expected, pAkt levels were higher in old cells than in young cells (Figure 1). Senescence-associated phosphorylated ERK expression, which was known to be changed in cells entering replicative senescence (32,33), was also elevated in old cells.



View larger version (54K):
[in this window]
[in a new window]
 
Figure 1. Expressions of Akt, FOXO3a, and ERK in young and old human dermal fibroblasts. Proteins (30 µg) extracted from young (Y) and old (O) cells were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and Akt/FOXO3a protein expressions were determined by Western blotting with antibodies against Akt, phospho-Akt (pAkt), FOXO3a, phospho-FOXO3a (pFOXO3a), ERK, phospho-ERK (pERK), and GAPDH (loading control). Representative data are from three independent experiments

 
Generation of FOXO3a-siRNA Stable Cells
To assess the regulatory role of FOXO3a activity in cellular senescence, we generated FOXO3a-siRNA stable cells. Following selection, cloning, and amplification of stable cells, the FOXO3a-siRNA cells and the vector-transfected cells were in passage 9. For the experiments, the FOXO3a-siRNA cells and the vector-transfected cells were used in passage 10 to passage 11 (population doublings < 33). RT-PCR showed that the level of FOXO3a RNA expression was lower in FOXO3a-siRNA stable cells than in young or vector-transfected cells (Figure 2A), and that the levels of FOXO1a and FOXO4 RNAs were unchanged (Figure 2A). Western blot analysis with anti-FOXO3a and anti-pFOXO3a antibodies demonstrated that FOXO3a protein was also down-regulated, but that pFOXO3a was up-regulated in FOXO3a-siRNA cells (Figure 2B). The levels of senescence-associated pERK expression were also increased in FOXO3a-siRNA cells. In addition, the expression patterns of FOXO3a, pFOXO3a, pAkt, and pERK in FOXO3a-siRNA cells were similar to those in old cells.



View larger version (38K):
[in this window]
[in a new window]
 
Figure 2. Down-regulation of FOXO3a in FOXO3a-siRNA stable cells. The levels of FOXO3a expression were confirmed by reverse transcription-polymerase chain reaction (A) and Western blot analysis (B). Levels of Akt, pAkt, pFOXO3a, ERK, and pERK expression were also measured. Y = young cells; O = old cells; V = vector-transfected cells; F = FOXO3a-siRNA stable cells

 
Senescence Phenotypes in FOXO3a-siRNA Cells
Senescent cells are resistant to mitogen-induced proliferation (34,35), express senescence-associated ß-gal (2), and have a characteristically enlarged, flattened morphology (3). We measured cell growth and senescence-associated ß-gal activity in FOXO3a-siRNA cells. FOXO3a-siRNA cells had an enlarged, flattened cell morphology, like old cells (Figure 3A). The percentage of blue cells (indicating senescence-associated ß-gal activity) was higher in FOXO3a-siRNA cells (33.9 ± 1.38%) than in vector-transfected cells (5.9 ± 1.0%) (Figure 3B). Population doubling times were also longer for FOXO3a-siRNA cells (2.27 ± 0.15 days) than for vector-transfected (1.36 ± 0.04 days) or young cells (0.86 ± 0.02 days) (Figure 3C). Moreover, increments of population doubling time in FOXO3a-siRNA cells resulted in growth retardation (data not shown). FOXO3a was also found to play an important role in the regulation of cellular redox status by increasing the level of manganese superoxide dismutase (Mn-SOD) (29). Therefore, we measured cellular ROS levels by using DHR123. Cellular ROS was found to be elevated in FOXO3a-siRNA cells as compared to vector-transfected cells (Figure 3D). To investigate whether elimination of ROS generated during cellular senescence could avert senescent phenotypes of the FOXO3a-siRNA cells, the cells were treated with 5 or 10 mM N-acetylcysteine for 2 or 3 days, and their morphology and senescence-associated ß-gal activities were examined. The flat and large cell characteristics of the FOXO3a-siRNA cells became similar to the morphology characteristics of young cells: small, slender, and cylindrical fibroblasts (data not shown). Senescence-associated ß-gal activities of the FOXO3a-siRNA cells were decreased by N-acetylcysteine in a time- and dose-dependent manner (Figure 4). Because the transcriptional activity of p53 and the up-regulation of p21 are essential for Akt-induced growth arrest in mouse embryonic fibroblasts (29) and for the replicative senescence of HDFs (32), we measured p53 and p21 protein expression. As expected, the levels of p53 and p21 proteins were up-regulated in FOXO3a-siRNA cells as well as in old cells (Figure 5A). We have previously shown that TPD52L1 and EPB41L3/Dal-1 proteins are down-regulated in senescent HDFs (36). In the present study, TPD52L1 and EPB41L3/Dal-1 proteins were also found to be down-regulated in FOXO3a-siRNA cells (Figure 5B).



View larger version (40K):
[in this window]
[in a new window]
 
Figure 3. Characterization of the cellular senescence of FOXO3a-siRNA stable cells. A, cell morphology (stained with Mayer's hematoxylin) and senescence-associated ß-galactosidase (SA ß-gal) staining (x100). B, Percentages of SA ß-gal positive cells. C, Measurement of population doubling time (PDT). Values are the means ± standard deviation of three independent experiments. D, Measurement of cellular reactive oxygen species using dihydrorhodamine 123. Y = young cells; O = old cells; V = vector-transfected cells; F = FOXO3a-siRNA stable cells

 


View larger version (22K):
[in this window]
[in a new window]
 
Figure 4. Effect of N-acetylcysteine on senescence-associated ß-galactosidase (SA ß-gal) activity in FOXO3a-siRNA cells. Cells were treated for an increasing time period with 10 mM N-acetylcysteine (A) or with increasing concentrations of N-acetylcysteine for 3 days (B). Values are the means ± standard deviation of three independent experiments. NT = not treated; Y = young cells; O = old cells; V = vector-transfected cells; F = FOXO3a-siRNA stable cells

 


View larger version (55K):
[in this window]
[in a new window]
 
Figure 5. Western blot analysis for p53, p21, TPD52L1, and EPB41L3/Dal-1 in FOXO3a-siRNA cells. Data are representative of three independent experiments. Y = young cells; O = old cells; V = vector-transfected cells; F = FOXO3a-siRNA stable cells

 

    DISCUSSION
 Top
 Abstract
 Methods
 Results
 Discussion
 References
 
In the present study, differences were found in Akt activation and FOXO3a inactivation in young and old HDFs. Whereas the levels of Akt protein expression were similar in young and old cells, the levels of FOXO3a protein were lower in old cells than in young cells, and pAkt (an active form) and pFOXO3a (an inactivated form) levels were higher in old cells, thus suggesting that the Akt-dependent inactivation of FOXO3a might induce the cellular senescence of HDFs. We found that down-regulation of FOXO3a RNA and protein expressions in HDFs induced a variety of senescent phenotypes, including changes in cell morphology; increases in population doubling times, senescence-associated ß-gal staining, and cellular ROS; and the up-regulation of p53/p21 protein expression and the down-regulations of TPD52L1 and EPB41L3/Dal-1 protein expression. Our data provide evidence for the key role of FOXO3a transcription factor as a mediator of cellular senescence in HDFs, and support previous findings about the critical role of Akt activation in the regulation of the life span of primary human endothelial cells via the inactivation of FOXO3a and the p53/p21-dependent pathway (29).

The FOXO subfamily—FOXO1, FOXO3a, and FOXO4—play important roles in regulating diverse cellular functions, such as differentiation, metabolism, proliferation, survival, and aging (13,14). However, the roles of the FOXO subfamily in the proliferation of human cells are still complicated. These FOXO factors induce cell cycle arrest in the G1 phase of the cell cycle by increasing the production of the cyclin-dependent protein kinase inhibitor p27kip in PTEN-deficient glioblastoma and Ras-transformed cells (15). Recently, Hu and colleagues (21) showed that the down-regulation of FOXO3a by FOXO3a-siRNA in human breast cancer MDA-MB cell lines induced cell proliferation and tumorigenesis in nude mice and that the ectopic expression of FOXO3a in the cells inhibited tumorigenesis in nude mice, suggesting that FOXO3a has general suppression effects for tumorigenesis in vivo. These results were obtained from the human cancer cell lines. However, we showed acceleration of cellular senescence by down-regulation of FOXO3a in human primary dermal fibroblasts. Miyauchi and colleagues (29) also reported that the suppression of FOXO3a in human endothelial cells induced cellular senescence via a p53/p21 pathway. Therefore, roles of FOXO transcription factors in cell proliferation and aging might depend on the physiological conditions and cell types in mammalian cells. Furthermore, in mice, knockout of the FOXO3a gene resulted in no apparent phenotype in relation to the cell proliferation except the ovarian follicular cells (27,28). However, in invertebrates, the DAF-16 (C. elegans) or dFOXO (Drosophila) signaling pathway plays a critical role in regulating body size and life span (22,37). These results suggest that the different effects of the FOXO members in mice and invertebrates may be due to diverse functions of the FOXO members in mice.

TPD52L1 was found to be overexpressed in some breast carcinomas (38) and was reported to be involved in H2O2-induced apoptosis by binding to and activating apoptosis signal-regulating kinase 1 (ASK-1) (39). EPB41L3/Dal-1 plays important roles in the maintenance of cell-cell and cell-substratum interactions and in cytoskeletal organization, which are important for controlling cellular growth and differentiation (40, 41). The down-regulations of TPD52L1 and EPB41L3/Dal-1 in FOXO3a-siRNA cells and in aged cells suggest that TPD52L1 and EPB41L3/Dal-1 play important roles in cellular senescence as target genes regulated by FOXO3a.

The insulin/PI3K/Akt signaling pathway has been known to play important roles in the control of longevity in organisms ranging from yeast to mice (11). Genetic studies have demonstrated that the ablations of insulin/IGF-1 receptor genes, daf-2 in C. elegans (42) and IGF-1R in mice (25), resulted in an increased life span. Moreover, mutations in age-1 of C. elegans, which is an evolutionarily conserved PI3K and is activated by DAF-2, also lead to a life-span extension (43). The active form of DAF-16, forkhead transcription factor, was found to be essential for the longevity of DAF-2 or AGE-1 mutant organisms (44). Therefore, the finding that FOXO3a RNA and protein down-regulation in HDFs accelerates cellular senescence suggests that the insulin/PI3K/Akt/FOXO pathway is critical for aging in primary cultured human fibroblasts, and that the mechanism of senescence is conserved in primary human cells.


    Acknowledgments
 
We thank K. S. Kwon for providing a GAPDH antibody, S. Cho for a TPD52L1 antibody, and I. Newsham for an EPB41L3/Dal-1 antibody. This study was supported by a grant from the Korea Health 21 R&D Project, Ministry of Health & Welfare, Republic of Korea (02-PJ10-PG6-AG01-0003).


    Footnotes
 
Decision Editor: James R. Smith, PhD

Received July 22, 2004

Accepted October 20, 2004


    References
 Top
 Abstract
 Methods
 Results
 Discussion
 References
 

  1. Hayflick L, Moorhead PS. The serial cultivation of human diploid cell strains. Exp Cell Res. 1961;25:585-621.[Medline]
  2. Dimri GP, Lee X, Basile G, et al. A biomarker that identifies senescent human cells in culture and in aging skin in vivo. Proc Natl Acad Sci U S A. 1995;92:9363-9367.[Abstract/Free Full Text]
  3. Wagner M, Hampel B, Bernhard D, et al. Replicative senescence of human endothelial cells in vitro involves G1 arrest, polyploidization and senescence-associated apoptosis. Exp Gerontol. 2001;36:1327-1347.[Medline]
  4. Smith JR, Pereira-Smith OM. Replicative senescence: implications for in vivo aging and tumor suppression. Science. 1996;273:63-67.[Abstract]
  5. Droge W. Oxidative stress and aging. Adv Exp Med Biol. 2003;543:191-200.[Medline]
  6. Weinert BT, Timiras PS. Invited review: Theories of aging. J Appl Physiol. 2003;95:1706-1716.[Abstract/Free Full Text]
  7. Samuels DC. Mitochondrial DNA repeats constrain the life span of mammals. Trends Genet. 2004;20:226-229.[Medline]
  8. Trifunovic A, Wredenberg A, Falkenberg M, et al. Premature ageing in mice expressing defective mitochondrial DNA polymerase. Nature. 2004;429:417-423.[Medline]
  9. Guarente L, Kenyon C. Genetic pathways that regulate ageing in model organisms. Nature. 2000;408:255-262.[Medline]
  10. Hamet P, Tremblay J. Genes of aging. Metabolism. 2003;52:(10 Suppl 2): 5-9.[Medline]
  11. Longo VD, Finch CE. Evolutionary medicine: from dwarf model systems to healthy centenarians. Science. 2003;299:1342-1346.[Abstract/Free Full Text]
  12. Coffer P. OutFOXing the grim reaper: novel mechanisms regulating longevity by forkhead transcription factors. Sci STKE. 2003;201:PE39.
  13. Carlsson P, Mahlapuu M. Forkhead transcription factors: key players in development and metabolism. Dev Biol. 2003;250:1-23.
  14. Accili D, Arden KC. FoxOs at the crossroads of cellular metabolism, differentiation, and transformation. Cell. 2004;117:421-426.[Medline]
  15. Medema RH, Kops GJ, Bos JL, et al. AFX-like Forkhead transcription factors mediate cell-cycle regulation by Ras and PKB through p27kip1. Nature. 2000;404:782-787.[Medline]
  16. Kops GJ, Medema RH, Glassford J, et al. Control of cell cycle exit and entry by protein kinase B-regulated forkhead transcription factors. Mol Cell Biol. 2002;22:2025-2036.[Abstract/Free Full Text]
  17. Alvarez B, Martinez AC, Burgering BM, et al. Forkhead transcription factors contribute to execution of the mitotic programme in mammals. Nature. 2001;413:744-747.[Medline]
  18. Kashii Y, Uchida M, Kirito K, et al. A member of Forkhead family transcription factor, FKHRL1, is one of the downstream molecules of phosphatidylinositol 3-kinase-Akt activation pathway in erythropoietin signal transduction. Blood. 2000;96:941-949.[Abstract/Free Full Text]
  19. Uddin S, Kottegoda S, Stigger D, et al. Activation of the Akt/FKHRL1 pathway mediates the antiapoptotic effects of erythropoietin in primary human erythroid progenitors. Biochem Biophys Res Commun. 2000;275:16-19.[Medline]
  20. Kops GJ, Dansen TB, Polderman PE, et al. Forkhead transcription factor FOXO3a protects quiescent cells from oxidative stress. Nature. 2002;419:316-321.[Medline]
  21. Hu MC, Lee DF, Xia W, et al. I{kappa}B kinase promotes tumorigenesis through inhibition of forkhead FOXO3a. Cell. 2004;117:225-237.[Medline]
  22. Murphy CT, McCarroll SA, Bargmann CI, et al. Genes that act downstream of DAF-16 to influence the lifespan of Caenorhabditis elegans. Nature. 2003;424:277-283.[Medline]
  23. Migliaccio E, Giorgio M, Mele S, et al. The p66shc adaptor protein controls oxidative stress response and life span in mammals. Nature. 1999;402:309-313.[Medline]
  24. Nemoto S, Finkel T. Redox regulation of forkhead proteins through a p66shc-dependent signaling pathway. Science. 2002;295:2450-2452.[Abstract/Free Full Text]
  25. Holzenberger M, Dupont J, Ducos B, et al. IGF-1 receptor regulates lifespan and resistance to oxidative stress in mice. Nature. 2003;421:182-187.[Medline]
  26. Bluher M, Kahn BB, Kahn CR. Extended longevity in mice lacking the insulin receptor in adipose tissue. Science. 2003;299:572-574.[Abstract/Free Full Text]
  27. Castrillon DH, Miao L, Kollipara R, et al. Suppression of ovarian follicle activation in mice by the transcription factor FOXO3a. Science. 2003;301:215-218.[Abstract/Free Full Text]
  28. Hosaka T, Biggs WH, III, Tieu D, Boyer AD, et al. Disruption of forkhead transcription factor (FOXO) family members in mice reveals their functional diversification. Proc Natl Acad Sci U S A. 2004;101:2975-2980.[Abstract/Free Full Text]
  29. Miyauchi H, Minamino T, Tateno K, et al. Akt negatively regulates the in vitro lifespan of human endothelial cells via a p53/p21-dependent pathway. EMBO J. 2004;23:212-220.[Medline]
  30. Hribal ML, Nakae J, Kitamura T, et al. Regulation of insulin-like growth factor-dependent myoblast differentiation by Foxo forkhead transcription factors. J Cell Biol. 2003;162:535-541.[Abstract/Free Full Text]
  31. Kim JR, Lee SR, Chung HJ, et al. Identification of amyloid ß-peptide responsive genes by cDNA microarray technology: involvement of RTP801 in amyloid ß-peptide toxicity. Exp Mol Med. 2003;35:403-411.[Medline]
  32. Cho KA, Ryu SJ, Park JS, et al. Senescent phenotype can be reversed by reduction of caveolin status. J Biol Chem. 2003;278:27789-27795.[Abstract/Free Full Text]
  33. Kim HS, Song MC, Kwak IH, et al. Constitutive induction of p-Erk1/2 accompanied by reduced activities of protein phosphatases 1 and 2A and MKP3 due to reactive oxygen species during cellular senescence. J Biol Chem. 2003;278:37497-37510.[Abstract/Free Full Text]
  34. Aggarwal BB, Totpal K, LaPushin R, et al. Diminished responsiveness of senescent normal human fibroblasts to TNF-dependent proliferation and interleukin production is not due to its effect on the receptors or on the activation of a nuclear factor NF-kB. Exp Cell Res. 1995;218:381-388.[Medline]
  35. Park WY, Park JS, Cho KA, et al. Up-regulation of caveolin attenuates epidermal growth factor signaling in senescent cells. J Biol Chem. 2002;275:20847-20852.
  36. Yoon IK, Kim HK, Kim YK, et al. Exploration of replicative senescence-associated genes in human dermal fibroblasts by cDNA microarray technology. Exp Gerontol. 2004;39:1369-1378.[Medline]
  37. Kramer JM, Davidge JT, Lockyer JM, et al. Expression of Drosophila FOXO regulates growth and can phenocopy starvation. BMC Dev Biol. 2003;3:5.[Medline]
  38. Byrne JA, Mattei MG, Basset P. Definition of the tumor protein D52 (TPD52) gene family through cloning of D52 homologues in human (hD53) and mouse (mD52). Genomics. 1996;35:523-532.[Medline]
  39. Cho S, Ko HM, Kim JM, et al. Positive regulation of apoptosis signal-regulating kinase 1 by hD53L1. J Biol Chem. 2004;279:16050-16056.[Abstract/Free Full Text]
  40. Tran YK, Bogler O, Gorse KM, et al. A novel member of the NF2/ERM/4.1 superfamily with growth suppressing properties in lung cancer. Cancer Res. 1999;59:35-43.[Abstract/Free Full Text]
  41. Charboneau AL, Singh V, Yu T, et al. Suppression of growth and increased cellular attachment after expression of DAL-1 in MCF-7 breast cancer cells. Int J Cancer. 2002;100:181-188.[Medline]
  42. Kenyon C, Chang J, Gensch E, et al. C. elegans mutant that lives twice as long as wild type. Nature. 1993;366:461-464.[Medline]
  43. Dorman JB, Albinder B, Shroyer T, et al. The age-1 and daf-2 genes function in a common pathway to control the lifespan of Caenorhabditis elegans. Genetics. 1995;141:1399-1406.[Abstract]
  44. Ogg S, Paradis S, Gottlieb S, et al. The Fork head transcription factor DAF-16 transduces insulin-like metabolic and longevity signals in C. elegans. Nature. 1997;389:994-999.[Medline]



This article has been cited by other articles:


Home page
Mol. Biol. CellHome page
K. S. Kim, Y. B. Seu, S.-H. Baek, M. J. Kim, K. J. Kim, J. H. Kim, and J.-R. Kim
Induction of Cellular Senescence by Insulin-like Growth Factor Binding Protein-5 through a p53-dependent Mechanism
Mol. Biol. Cell, November 1, 2007; 18(11): 4543 - 4552.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
X. Zheng, Z. Yang, Z. Yue, J. D. Alvarez, and A. Sehgal
FOXO and insulin signaling regulate sensitivity of the circadian clock to oxidative stress
PNAS, October 2, 2007; 104(40): 15899 - 15904.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kyoung Kim, H.
Right arrow Articles by Kim, J.-R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kyoung Kim, H.
Right arrow Articles by Kim, J.-R.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
All GSA journals The Gerontologist
Journals of Gerontology Series B: Psychological Sciences and Social Sciences